Review



antisense primer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Thermo Fisher antisense primer
    Antisense Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 14161 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primer/product/Thermo Fisher
    Average 96 stars, based on 14161 article reviews
    antisense primer - by Bioz Stars, 2026-03
    96/100 stars

    Images



    Similar Products

    primer antisense mix  (New England Biolabs)
    97
    New England Biolabs primer antisense mix
    Primer Antisense Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer antisense mix/product/New England Biolabs
    Average 97 stars, based on 1 article reviews
    primer antisense mix - by Bioz Stars, 2026-03
    97/100 stars
    		  Buy from Supplier
    antisense primer  (Thermo Fisher)
    96
    Thermo Fisher antisense primer
    Antisense Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primer/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    antisense primer - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    pcr antisense primer #1428  (PEQLAB)
    90
    PEQLAB pcr antisense primer #1428
    Pcr Antisense Primer #1428, supplied by PEQLAB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr antisense primer #1428/product/PEQLAB
    Average 90 stars, based on 1 article reviews
    pcr antisense primer #1428 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    antisense-primer  (Sangon Biotech)
    90
    Sangon Biotech antisense-primer
    Antisense Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense-primer/product/Sangon Biotech
    Average 90 stars, based on 1 article reviews
    antisense-primer - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    assay (20x) containing sense antisense primers taqman® probes  (Thermo Fisher)
    90
    Thermo Fisher assay (20x) containing sense antisense primers taqman® probes
    Assay (20x) Containing Sense Antisense Primers Taqman® Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/assay (20x) containing sense antisense primers taqman® probes/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    assay (20x) containing sense antisense primers taqman® probes - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    antisense primer  (TaKaRa)
    96
    TaKaRa antisense primer
    Antisense Primer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/antisense primer/product/TaKaRa
    Average 96 stars, based on 1 article reviews
    antisense primer - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    car r2 antisense primer  (New England Biolabs)
    96
    New England Biolabs car r2 antisense primer
    Car R2 Antisense Primer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/car r2 antisense primer/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    car r2 antisense primer - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    egr1 antisense primer  (Metabion International AG)
    90
    Metabion International AG egr1 antisense primer
    The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples
    Egr1 Antisense Primer, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/egr1 antisense primer/product/Metabion International AG
    Average 90 stars, based on 1 article reviews
    egr1 antisense primer - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: The Different Expression of Key Genes in Renal Tubule Interstitium. Lupus Nephrities Samples versus Normal Samples

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques: Expressing

    The expression and diagnosis significance of IFI16, EGR1 and MX1 in LN. ( A ) IFI16 expression was distinctly upregulated in LN samples; ( C ) EGR1 expression was distinctly downregulated in LN samples; ( E ) MX1 expression was distinctly upregulated in LN samples. ( B / D / F ) Receiver operating characteristic (ROC) curves for IFI16, EGR1 and MX1 in LN. Normal samples n=35, LN samples n=91.

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: The expression and diagnosis significance of IFI16, EGR1 and MX1 in LN. ( A ) IFI16 expression was distinctly upregulated in LN samples; ( C ) EGR1 expression was distinctly downregulated in LN samples; ( E ) MX1 expression was distinctly upregulated in LN samples. ( B / D / F ) Receiver operating characteristic (ROC) curves for IFI16, EGR1 and MX1 in LN. Normal samples n=35, LN samples n=91.

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques: Expressing, Biomarker Discovery

    Immune cell infiltration analysis of lupus nephrities. ( A ) Violin diagram of 22 types of immune cells between normal and LN specimens. Correlation of core genes IFI16 ( B ), EGR1 ( C ), MX1 ( D ) with infiltrating immune cells; the vertical ordinate represents the name of the immune cell and the abscissa represents the correlation coefficient; the circle size represents the absolute value size of the correlation coefficient.

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: Immune cell infiltration analysis of lupus nephrities. ( A ) Violin diagram of 22 types of immune cells between normal and LN specimens. Correlation of core genes IFI16 ( B ), EGR1 ( C ), MX1 ( D ) with infiltrating immune cells; the vertical ordinate represents the name of the immune cell and the abscissa represents the correlation coefficient; the circle size represents the absolute value size of the correlation coefficient.

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques:

    Renal pathology and expression of IFI204, EGR1 and MX1 in tubular epithelial cells in LN. ( A ) HE staining of control mice kidney tissue sections. ( B ) HE staining of MRL/lpr mice kidney tissue sections. ( C ) The protein of IFI204, EGR1 and MX1 levels were examined in protein extracts from tubular epithelial cells of MRL/lpr or C57BL/6 mice, and ( D-F ) RT-qPCR for the levels of mRNA levels of EGR1, MX1 and IFI204 of tubular epithelial cells isolated from MRL/lpr or C57BL/6 mice. All data were shown as mean ± SD.

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: Renal pathology and expression of IFI204, EGR1 and MX1 in tubular epithelial cells in LN. ( A ) HE staining of control mice kidney tissue sections. ( B ) HE staining of MRL/lpr mice kidney tissue sections. ( C ) The protein of IFI204, EGR1 and MX1 levels were examined in protein extracts from tubular epithelial cells of MRL/lpr or C57BL/6 mice, and ( D-F ) RT-qPCR for the levels of mRNA levels of EGR1, MX1 and IFI204 of tubular epithelial cells isolated from MRL/lpr or C57BL/6 mice. All data were shown as mean ± SD.

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques: Expressing, Staining, Control, Quantitative RT-PCR, Isolation

    Expression of target protein in renal tubular with LN patients. Co-localisation of target proteins (pink) ( A) EGR1, ( B) IFI16 and ( C) MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: Expression of target protein in renal tubular with LN patients. Co-localisation of target proteins (pink) ( A) EGR1, ( B) IFI16 and ( C) MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques: Expressing, Marker, Staining

    Expression of target protein in renal tubular within MRL/lpr. Co-localisation of target proteins (pink) ( A ) EGR1, ( B ): IFI204 and ( C ): MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

    Journal: Journal of Inflammation Research

    Article Title: Macrophage Infiltration Correlated with IFI16, EGR1 and MX1 Expression in Renal Tubular Epithelial Cells Within Lupus Nephritis-Associated Tubulointerstitial Injury via Bioinformatics Analysis

    doi: 10.2147/JIR.S489087

    Figure Lengend Snippet: Expression of target protein in renal tubular within MRL/lpr. Co-localisation of target proteins (pink) ( A ) EGR1, ( B ): IFI204 and ( C ): MX1, F4/80 (red) (marker of macrophage), and Megalin (green) (marker of the renal tubules). DAPI was used for nuclear staining. LN, lupus nephritis; DAPI, 4′,6-diamidino-2-phenylindole.

    Article Snippet: The following primers were obtained from Metabion (Martinsried, Germany): EGR1 sense: CGTCCTGTTCCCTTTGACTT , antisense: GCATGTGATGGAGAGGATACTG ; MX1 sense: AGATGAGGAGAGAGGAGCTATG, antisense: CCAGTACATCCTCCTGACAAAG; IFI204 sense: TGACTTAGCTGCCTACCTACT, antisense: GCTGAGCCTTCCTGGATATTT; β-actin sense: GGCTGTATTCCCCTCCATCG, antisense: CCAGTTGGTAACAATGCCATGT. β-actin was used as an internal reference.

    Techniques: Expressing, Marker, Staining